Hence, there is an urgent need for engineering new antimalarial compounds having novel mechanisms of action. Ten plasmepsins (PMs) have been reported from the genome of export element (PEXEL), a pentameric Mdivi-1 motif (R/KxLxE/Q/D) [11,12]. is responsible for cleavage of PEXEL [8,9,13] and Mdivi-1 is thus required for parasite protein export mediation [8,9,13,14]. For this reason, PMV could be an important target in the development of novel, effective antimalarial drugs [8C10] particularly in consideration of recently published findings regarding the engineering of a PEXEL-mimetic inhibitor that was shown to effectively kill parasites via direct action against PMV [15], a potentially critical advance in the fight against malaria. In order to facilitate the development of specific inhibitors with antimalarial activities, the elucidation of structure-function relationships of PMV, particularly with respect to its modes of proteolysis, inhibition and activation, are important starting points in the initial work towards a level of understanding Mdivi-1 that facilitates structure elucidation, and ultimately inhibitor Mdivi-1 design. The present study reports the recombinant expression, pH conditions for optimal activity, inhibitor testing, and most importantly the finding that the prosegment is apparently non-essential for obtaining proteolytic activity and ligand binding. 2.?Materials and methods 2.1. Materials pET32b(+) and pET19b(+) vectors, Rosetta-gami B (DE3)pLysS, BugBuster? reagent and u-MAC? cartridges were purchased from Merck KGaA (Darmstadt, Germany). A synthetic 44-residue peptide corresponding to the PMV prosegment (ENKIDNVGKKIENVGKKIGDMENKNDNVENKNDNVGNKNDNVKN) was purchased from GenicBio (Shanghai, China). A quenched fluorescent synthetic peptide substrate (HRPII; 4-(4-dimethylaminophenyl) diazenylbenzoic acid (DABCYL)-LNKRLLHETQ-E(5-[(2-Aminoethyl)amino]naphthalene-1-sulfonic acid) (EDANS), and LA mutant HRPII DABCYL-LNKRLAHETQ-E(EDANS), was purchased from CanPeptide (Pointe-Claire, QC, Canada). All other chemicals and media were obtained from Fisher Scientific Canada (Nepean, ON, Canada) or SigmaCAldrich (St. Louis, MO, USA). 2.2. Cloning and construction Mdivi-1 of soluble expression vectors The gene encoding for zymogenic PMV (proPMV) [9] was amplified from the genomic DNA of 3D7 (MR4/American Type Culture Collection, Manassas, VA, USA) using primers PMVF109 (5GCACCATGGAAAATAAAATTGACAATGTTG) and PMVR1563 (5AATCCATGGCTAATTAGATGGGCATTTAGATTC). Product was digested with was fused to a fragment of (codon-optimized synthetic genes for mature PMV and proPMV were purchased from GenScript (Piscataway, NJ, USA). The former was amplified using primers 5-GCACCATGGCGAGCTCTGATCTGTATAAATAC and 5AATCTCGAGTTAATGGTGATGGTGATGGTGGTTACTCGGACACTTAGATTC, and subsequently subcloned into pET19b(+) at the containing a C-terminal His6 tag. was amplified using primers 5GCACCATGGCTCATCATCATCATCATCATGAAAACAAGATCGATAACGTG and 5AATCTCGAGTTAGTTACTCGGACACTTAGATTC, and inserted at the I and I restriction sites yielding and Rosetta-gami B (DE3)pLysS (for soluble expression) transformed with expression vector constructs were cultured, induced and harvested as per the manufacturers instructions. Frozen cell pellets were resuspended in BugBuster? cell lysis reagent and incubated at room temperature for 20 min with gentle shaking. Soluble and insoluble materials were separated by centrifugation at 16,000 g for 20 min at 4C. Insoluble protein was solubilized in 50 mM Tris-HCl pH 9.0 buffer containing 8 M urea and 10 mM Cmercaptoethanol. To optimize refolding conditions, solubilized protein solution was diluted 20-fold in various refolding buffers having different pH, ratio of oxidized:reduced glutathione, as well as addition of varying concentrations of urea, NaCl, glycerol, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), MgSO4, Tween-20, Triton X-100, sucrose, arginine, 2-(Cyclohexylamino)ethanesulfonic acid PTCRA (CHES) and KCl. Refolding efficiency was assessed as per Russo Rosetta-gami B (DE3)pLysS. Fusion protein was identified by Western blotting using anti-thioredoxin primary antibody (Invitrogen, Burlington, ON, Canada) as well as N-terminal sequence analysis. Soluble expression of fusion protein in usable quantities was unsuccessful (data not shown), therefore, inclusion bodies were then refolded and purified for subsequent analyses. Various conditions that were previously reported to aid in refolding [21,22] were screened, and assessment of refolding efficiency was based on HRPII substrate activity and amount of aggregation detected on non-reducing SDS-PAGE. The best combination for refolding was 50 mM Tris-HCl pH.